research centers


Search results: Found 12

Listing 1 - 10 of 12 << page
of 2
>>
Sort by

Article
PRE-IDENTIFICATION

Author: Aqeel Ketab Mezaal Al-khafaji
Journal: Journal of Kufa for Mathematics and Computer مجلة الكوفة للرياضيات والحاسوب ISSN: 11712076 Year: 2014 Volume: 2 Issue: 2 Pages: 8-10
Publisher: University of Kufa جامعة الكوفة

Loading...
Loading...
Abstract

In this paper, we introduced and investigated the notion of pre-identification using the notion of preopen sets introduced by Mashhour [2], and work of Al-kutaibi [1].


Article
Automatic Object Identification in an Annotated Image using Latent Semantic Analysis
تعریف الكیانات أوتوماتكیا في الصورة الموصوفة بأستخدام خوارزمیة LSA

Author: Haithem Kareem Abass ھیثم كریم عباس*
Journal: AL-MANSOUR JOURNAL مجلة المنصور ISSN: 18196489 Year: 2014 Issue: 21 Pages: 103-120
Publisher: Private Mansour college كلية المنصور الاهلية

Loading...
Loading...
Abstract

Object identification is the process of mapping visual areas within animage to human been concepts, this is a vital approach to unify imageunderstanding between machines and human. Anyway, images in theInternet are retrieved using natural language query where search enginesimplement text match to the textual description attached to images.Current image retrieval engines produce huge disturbance in fulfilling userquery due to the nature of text matching technique where many un-wantedresults are obtained.In this paper a new model is presented primarily to automatically identifyobjects composing an image and map identified objects to attachedannotations; this is implemented in this paper by using LSA (LatentSemantic Analysis). This approach has lead to secondary revenue whereannotations have been de-noised from an-wanted words. A real casestudy has been taken to verify the hypothesis of this paper and resultantcalculations approved the approach.

تعریف الكیانات في صورة ھي عملیة ربط المساحات البصریة بما یقابلھا من مفاھیم معروفة للانسان، ھذهالعملیة حیویة جدا لتوحید عملیة فھم الصورة بین الماكنة والانسان، حیث ان الصور في الانترنیت یتماسترجاعھا عن طریق استعلام معتمد على اللغات الطبیعیة حیث ان محركات البحث تنفذ عملیة المطابقةالنصیة للنصوص المرافقة للصور في عملیة الاسترجاع.ان محركات البحث الحالیة تنتج الكثیر من الفوضى في الاستجابة لطلب المستخدم وذلك بسبب طبیعةعملیة مطابقة النصوص مما ینتج عنھ الكثیر من النتائج الغیر مطلوبة.في ھذا البحث تم عرض نموذج جدید لعملیة تعریف المكونات التي تكون الصورة وربط ھذه المكونات معوالتي عند استخدامھا تم LSA مفردات توصیف الصورة، ھذا الربط تم من خلال استخدام خوارزمیةالحصول على فوائد اخرى ثانویة تتمثل في ازالة الكلمات الفائضة من التوصیف.تم اخذ حالة حقیقیة للتحقق من الفرضیات المطروحة في ھذا البحث حیث اثبتت الحسابات والنتائج صحةھذه الفرضیات


Article
A Proposed Methodology for Identifying and Evaluating an E-Forms Application

Authors: Imad H. AL-Hussaini --- Mustafa Ismail Ibrahim
Journal: Iraqi Journal for Computers and Informatics ijci المجلة العراقية للحاسبات والمعلوماتية ISSN: 2313190X 25204912 Year: 2014 Volume: 41 Issue: 1 Pages: 32-38
Publisher: University Of Informatics Technology And Communications جامعة تكنولوجيا المعلومات والاتصالات

Loading...
Loading...
Abstract

In order to develop a specific methodology that can be followed by any organization or individual who needs to choose the appropriate E-Forms application that could meet the required needs, this research proposes a methodology which consists of three phases: Identification phase, Evaluation phase and Testing phase. In the first phase, a general survey on E-Forms types and technologies is introduced with focus on the recent trends in order to identify which type mostly meets the user's general requirements. In the second phase, an evaluation to make an accurate selection is made to some of the top competing applications supporting the type identified in first phase by using a specific evaluation methodology, in this research three of the widely used evaluation methodologies are discussed, in addition to a simple evaluation methodology which has been proposed and implemented using "Microsoft Excel Sheets" application. Finally in the third phase, a real test is made using the winner application resulting from the second phase, where a four-stage testing plan is proposed in order to achieve this purpose. As an example, the E-Forms technology which is based on "Extensible Markup Language (XML)" is identified due to its features and capabilities. Then the evaluation is made to the top applications supporting this technology, where "Adobe's XML Forms Architecture (XFA)" technology is selected as a winner. This winner application then is tested, where samples of forms were designed to show the extraordinary features this technology can offer including digital signature. The test includes the use of a proposed offline forms' data gathering technique and uses "Oracle 10g" as the back-end database. It also includes a website to publish the designed forms in addition to an application developed using "Oracle Developer 10g" to process the forms' data for one of the designed samples in order to prove these forms' accuracy.

من اجل وضع منهجية محددة والتي بالامكان اتباعها من قبل اي مؤسسة او فرد بحاجة الى اختيار تطبيق للإستمارات الإلكترونية ملائم وباستطاعته تحقيق ما يحتاجه من متطلبات، فان هذا البحث يقترح منهجية تتضمن ثلاثة مراحل: مرحلة التحديد، مرحلة التقييم ومرحلة الإختبار.كمثال على ذلك يتم تحديد تكنولوجيا الأستمارات الإلكترونية المعتمدة في معماريتها على "لغة التوصيف الموسعة Extensible Markup Language(XML)" نظراً للميزات والقابليات التي تتمتع بها. بعد ذلك يجرى التقييم لأبرز التطبيقات التي تدعم هذه التكنولوجيا بالاعتماد على منهجية تقييم سهلة تم اقتراحها وتنفيذها باستخدام تطبيق " جداول مايكروسوفت اكسيل Microsoft Excel Sheets" كأداة ، حيث يتم اختيار تكنولوجيا " معمارية الاستمارة باعتماد لغة التوصيف الموسعة Architecture(XFA)XML Form" من شركة " أدوبي Adobe" كفائز. بعدها يتم اختبار هذا التطبيق الفائز، حيث ان عينات من الاستمارات تم تصميمها من اجل بيان الميزات الرائعة التي بالامكان ان توفرها هذه التكنولوجيا ومن ضمنها التوقيع الألكتروني. يتضمن الأختبار استخدام تقنية مقترحة لجمع بيانات الأستمارات لا تحتاج بالضرورة لوجود ارتباط مع شبكة ويستخدم" اوراكل النسخة العاشرة Oracle 10g" كقاعدة بيانات نهائية. كذلك يتضمن موقع الكتروني لنشر الاستمارات المصممة بالاضافة الى تطبيق تم تطويره باستخدام "مطور اوراكل النسخة العاشرة Oracle Developer 10g" لمعالجة بيانات الأستمارات لحد العينات المصممة وذلك من اجل اثبات دقة هذه الاستمارات.

Keywords

E-Forms --- Methodology --- Identification --- Evaluation --- Testing --- XML


Article
Modified On-Line RLS Identification for Condition Monitoring †

Authors: Dr. Mazin Z. Othman1 --- Shaima B. Ayoob2
Journal: IRAQI JOURNAL OF COMPUTERS,COMMUNICATION AND CONTROL & SYSTEMS ENGINEERING المجلة العراقية لهندسة الحاسبات والاتصالات والسيطرة والنظم ISSN: 18119212 Year: 2014 Volume: 14 Issue: 3 Pages: 52-58
Publisher: University of Technology الجامعة التكنولوجية

Loading...
Loading...
Abstract

Abstract – The Recursive Least Squares (RLS) is usually utilized in controlapplications as in self-tuning strategy to estimate the plant discrete-time transferfunction. Furthermore, it can be used as a tool to continuously monitoring the operatingcondition of the plant under control. However, in such applications, the RLS should bealways in a “wake up” state so that it can estimate, in a few sampling time, the planttransfer function after any abrupt change in its dynamic.In this work, two modifications to the standard RLS are presented. The firstmodification is called the “switching forgetting factor” while the other is called the”resetting covariance matrix”. The two modifications are applied, under LabVIEWenvironment, on-line to estimate the proper transfer function of a DC motor as anexample to show their capabilities to monitor the motor operation. It is found that withthese modifications, the RLS can estimate the plant transfer function much faster incomparison to the standard RLS algorithm.


Article
Neural Network Based on Model Reference Using for Robot Arm Identification and Control
استخدام الشبكة العصبية اعتمادا" على النموذج المرجعي للتحكم و مطابقة ذراع الربوت

Authors: Rafid A. Khalil رافد احمد خليل --- Rakan Kh. Antar راكان خليل عنتر
Journal: AL Rafdain Engineering Journal مجلة هندسة الرافدين ISSN: 18130526 Year: 2014 Volume: 22 Issue: 4 Pages: 100-109
Publisher: Mosul University جامعة الموصل

Loading...
Loading...
Abstract

In this work, neural network control theory is applied to identify and control the robot arm with two links conformed by two equations of second order which alternate their operation simultaneous. A neural network is trained to learn the robot arm in the dynamic behavior. The simulation results of the neural network controller based on model reference that used to identify and control the robot arm give very close results.

في هذا البحث، يتم تطبيق نظرية التحكم في الشبكة العصبية للسيطرة ومطابقة ذراع الروبوت ذو مفصلين والذي يتم تشغيله في وقت واحد والتعبير عنه بمعادلتين من الدرجة الثانية. يتم تدريب الشبكة العصبية للتعرف على تصرف ذراع الروبوت في السلوك الديناميكي. نتائج المحاكاة لتدريب الشبكة العصبية اعتمادا على النموذج المرجعي الذي استخدم للمطابقة والسيطرة على ذراع الروبوت اعطت نتائج قريبة جدا.


Article
Identification Of Trichophyton rubrum Using Polymerase Chain Reaction
تشخیص الفطر ترایكوفایتون روبرم بأستخدام تفاعل البلمرة المتسلسل

Loading...
Loading...
Abstract

Trichophyton rubrum is an anthropophilic dermatophyte that is distributed worldwide and causes common cutaneous disease such as mycosis . Although several properties of this fungus have been investigated so far , however , a few studies were carried out in the field of molecular biology of this fungus .In the present study the application of PCR fingerprinting was performed using two primers : forward 5'TGGTCTGGCCTTGACTGACC3' and Reversed 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' for the purpose of species identification .Trichophyton rubrum isolates obtained from either human patients (5 isolates) and animals ( 5 isolates ) with dermatophytosis were prospectively isolated by cultures and identified on morphological basis at Baghdad University , Department of Dermatology , College of Medicine and College of Veterinary Medicine respectively from the period September 2010 till March 2011 .Trichophyton rubrum isolates were subjected to DNA extraction .Conventional PCR was done with Trichophyton rubrum specific primers 5 ' TGGTCTGGCCTTGACTGACC 3 ' and 5 ' GTAAGGATGGCTAGTTAGGGGG 3 ' .Six isolates were positive for DNA extraction .A single band corresponding to Trichophyton rubrum was obtained .The results of current study suggest that PCR is simple , rapid and sensitive method for diagnosis of dermatophyte infections .

تعتبر الترايكوفايتون روبرم من الفطريات المحبة للبشر متوزعة في العالم وتسبب الاصابات الفطرية الجلدية مثل المايكوسس . وبالرغم من ان هذة الصفات العديدة لهذا الفطر تم التحري عنها ولكن هنالك دراسات قليلة اجريت في حقل البايولوجي الجزيئي في هذا المجال .في هذة الدراسة تم استخدام فحص البلمرة المتسلسل بوجود نوعان من البرايمير : الاول: 5 ' TGGTCTGGCCTTGACTGACC 3 'والثاني : 5 ' GTAAGGATGGCTAGTTAGGGGG 3 'لغرض التشخيص .تم الحصول على خمسة عزلات مأخوذة من الانسان وخمسة عزلات من الحيوانات حيث تم تشخيصها بواسطة الزرع الفطري في شعبة الامراض الجلدية/ كلية الطب /جامعة بغداد وكلية الطب البيطري /جامعة بغداد بالتسلسل للفترة من ايلول /2010 ولفاية أذار /2012 وقد اخضعت هذة العزلات الى استخلاص DNA مع أستخدم تفاعل البلمرة المتسلسل العادي وكانت ستة عزلات اعطت وجود DNA وتم تحديدها على شكل Band .هذة الدراسة تقترح بأن فحص تفاعل البلمرة المتسلسل هو بسيط ,وسريع وطريقة حساسة لتشخيص أصابات الفطريات الجلدية.


Article
Isolationand Identification of mouse bone marrow derived mesenchymal stem cells
عزل وتشخيص الخلايا الجذعية اللحمية المشتقة من نخاع عظم الفئران

Loading...
Loading...
Abstract

Bone marrow derived mesenchymal stem cells (BM-MSCs) were successfully used in regenerative medicine. The purpose of this study was to isolate and characterize mesenchymal stem cells from mouse bone marrow for their subsequent use in researches. Previous data suggest that BM-MSCs are typically enriched by plastic adherent cultures, fibroplastoid cell fraction. However, Identification of MSCs achieved through their morphology, phenotypic characteristics and their biological behavior. The cellular morphology played a major part in identifying MSCs in vitro. In general, immature MSCs appeared as small, spindle-shaped cells, whereas mature MSCs was displayed as larger cells with a flat, polygonal morphology. Cells also tended to be locally confluent, growing in distinct colonies. Immunophenotypic analysis demonstrated that mouse BM-MSCs at passage three uniformly positive for CD44, CD90, CD105 and CD106. However, MSCs were always found to be negative for heamatopoietic specific markers CD34, CD45, and endothelial marker CD31. By concluding, mesenchymal stem cells can be successfully derived from mouse bone marrow by direct plating method. These cells represent a valuable source of stem cells for restoring the damaged organs.

استخدمت الخلايا الجذعية اللحمية المشتقة من نخاع العظم بنجاح في الطب التجديدي. هدفت الدراسة الحالية الى عزل وتوصيف الخلايا الجذعية اللحمية من نخاع عظم الفأر لغرض استخدامها في المجالات البحثية.أوضحت معطيات البحوث السابقة بأن الخلايا الجذعية اللحمية المشتقة من نخاع العظم يمكن اغناؤها فقط بواسطة التصاقها بالمزارع البلاستيكية.وفصل الخلايا الليفية المولدة. ان تشخيص الخلايا الجذعية اللحميةيتم من خلال الشكل، والصفات الوراثية المظهرية، والسلوك البيولوجي لها. ويلعب الشكل الخلوي دورا مهما لتشخيص الخلايا الجذعة اللحمية في المزرعة. وبشكل عام، تظهر الخلايا الجذعية اللحمية الفتية صغيرة الحجم ومغزليه بينما تظهر الناضجة منها بشكل خلايا كبيرة الحجم، مسطحة ومتعددة الاضلع. وتميل الخلايا الى التجمع موضعيا والنمو في مستعمرات محددة.أظهرت نتائج تحليل الكيمياء النسيجية المناعية للخلايا الجذعية اللحمية بانها ذات استجابة موجبة لل CD44، CD90، CD105، CD106، وبنسبه منخفضه لل nestin. وذات استجابة سالبة للمعلمات المتخصصة بالخلايا الدميةCD34، CD45، والمعلم الظهاريCD31. ويمكن الاستنتاج بإمكانية عزل الخلايا الجذعية اللحمية وبنجاح من نخاع عظم الفئران البيض بالطريقة المباشرة والتي تعتبر مصدرمهم للخلايا الجذعية لتعويض الأعضاء المتضررة.


Article
Molecular Identification of Fungi Myceliopthora verrucosa which Producing Laccase Enzyme
التشخيص الجزيئي للفطر Myceliopthora verrucosa المسؤول عن إفراز أنزيم اللاكييز

Loading...
Loading...
Abstract

Polymerase chain reaction (PCR) of ITS region was used to identify the fungus isolated from plastic garbage which can produce laccase enzyme. DNA bands were purified from agarose gel and then sequenced and after entering these nucleotides to the data base it was found that the DNA band belongs to the genus Myceliopthora verrucosa in 100% matching. This method is a very sensitive method for the identification of species and strains of fungi as well as its simplicity in comparing between fungi species.

استخدمت طريقة تضاعف سلسلة متعدد البلمرة لمنطقة الحيز ألاستنساخي الداخلي ITS لتشخيص الفطر المسؤول عن إنتاج أنزيم اللاكييز المعزول مسبقا من المخلفات البلاستيكية حيث تم استخلاص حزم الــ DNA من هلام الاكاروز وإجراء عملية إيجاد تسلسل القواعد النتروجينية وبعد إدخال التسلسل في قاعدة البيانات وجد أن الــDNA المعزول يعود إلى الفطر Myceliopthora verrucosa وبنسبة تطابق 100 % إن هذه الطريقة تعد من الطرائق الدقيقة في تشخيص الفطريات على مستوى النوع وبين النوع بالإضافة إلى سهولتها للمقارنة بين الفطريات والتفريق بينها.


Article
Predicting the Gender of the Kurdish Writers in Facebook
تخمین جنس الکاتب الکردی فی شبکە التواصل الاجتماعی فیسبوک

Author: Peshawa J. Muhammad Ali
Journal: Sulaimania Journal for Engineering Sciences مجلة السليمانية للعلوم الهندسية ISSN: 24101699/24156655 Year: 2014 Volume: 1 Issue: 1 Pages: 18-28
Publisher: university of Sulaimania جامعة السليمانية

Loading...
Loading...
Abstract

Facebook is one of the social networks which have lots of users among Kurdish people. Although there are no formal or published statistics about the number of the Facebook users, in the last few years Facebook was the most used website among Kurdish society. This swift development of the Kurdish society towards Facebook imposes new challenges that need to be addressed. For example, a poem or an article published on Facebook possesses properties such as author name, gender, age, and nationality among others. In this paper the gender of Kurdish authors in Facebook determined by using a feed-forward artificial neural network model. 120 Facebook Kurdish written posts were used for learning the model designed to determine the gender of Kurdish writers in Facebook. The posts were taken from Facebook pages of different persons with different backgrounds. Twenty eight text features were extracted from each post; these features were distinct in discriminating between genders. The feed-forward back-propagation artificial neural network with three layers (28 nodes, 14 nodes, 1 node) is used as a classification technique. The accuracy ratio which based on the ten-fold technique (taking the average ratio among ten trials) obtained was 77.5 %. This proposed idea of this paper is important for detecting the real gender of Facebook page owners.

فةيسبووك يةكيَكة لة تؤرِة كؤمةلاَيةتييةبةناوبانطةكان ، لة ناو خةلَكى كوردستانيشدا بةكارهيَنةريَكى زؤرى هةية. لةو ضةند سالَةى دوايي دا تيَبينى دةكريَت كة فةيسبووك ئةو ويَبسايتة بووة كةزؤرترين كةس لة كوردستاندا سةردانيان كرددوة. ئةو طةشةسةندنة خيَراية هةنديَك رِةهةندي نويَي بةدواى خؤيداهيَنا بؤ نموونة كاتيَك ثؤستيَك يان نوسينيَك لةسةر لاثةرِةى فةيسبووكى تايبةتى كةسيَك بلاَودةكريَتةوة،هةلَطرى هةنديَك سيفاتى خاوةنى نووسينةكةية كة دةتوانريَت بدؤزريَتةوة وةك جيَندةر يان تةمةنى كةسى نووسةر يان ئايا خةلَكى ضي دةظةريَكة.لةو تويَذينةوةيةدا هةستاوين بة ديارى كردنى رِةطةزى ئةو كةسةى كة ثؤستيَك بلاَو دةكاتةوة لة فةيسبووك لة رِيَطاى شيَوازى نووسينةكةيةوة بة بةكارهيَنانى تةكنيكة ذيريةكان وة هةلَيَنجانى زانيارى لة تيَكست. هةستاين بة كؤكردنةوةى 121 ثؤستى جياواز كة هى كةسانى جياواز بوون لة شيعر و نووسينى كوردى، 28 خاسيةتى جياواز لة هةريةكة لةو بابةتانة دةرهيَنران، وة مؤديَلَكى ذيري تايبةت كة)نيورِةلأ نيَتؤرك - Neural network ( تيايدا بةكارهيَنرابوو ئامادةكرا. دواتر مؤديَلةكة فيَركرا كة هةستيَت بة جياكارى لةنيَوان رِةطةزى نوسةر لةسةر بنةماى نووسينةكةى واتا ئايا نووسةر نيَرة يان ميَ ية؟ % رِيَذةى دروستى خةملاَندنةكان بريتى بوو لة 77.7 )ريَذةى ناوةند لة دة جار دا بة ريَطاى Ten-fold (. ئةو تويَذينةوةية طرنطة بؤ ئاشكرا كردنى ئةو كةسانةى كة لة تؤرِة كؤمةلاَيةتي يةكاندا هةلَدةستن بةطؤرِينى كةسايةتىخؤيان وة لةوانةية ضةندين كارى ساختةكارى ثيَ ئةنجام بدةن.


Article
Vacillation between Identities in The Poetry of Theodore Roethke

Author: Muthanna Makki Muhammed
Journal: Journal of University of Babylon مجلة جامعة بابل ISSN: 19920652 23128135 Year: 2014 Volume: 22 Issue: 4 Pages: 827-835
Publisher: Babylon University جامعة بابل

Loading...
Loading...
Abstract

This paper investigates the ideas of the American poet Theodore Roethke (1908-1963) on identity and the mystical concept of identification in his poetry.The paper is divided into three sections. Section one is an introduction that starts with a brief account of the poet's life and thought. This is followed by brief notes on the influences on Roethke's thought and poetry.Section two contains the main body of the paper; in which the researcher reveals Roethke's vision of the cosmos in relation to its constituent parts. The discussion sheds light onto two aspects: the human self and the material world, and the human self and Divinity. The poems chosen for the study show the poet's attempt to reveal the bonds that tie the inner self with the physical world on one hand, and with divinity on the other; they also exhibit the fluctuation of the speaker's identity and his assuming different identities during his spiritual communion with the outside world.Finally, the paper ends with a conclusion that sums up the findings of the study.

‘يعنى هذا البحث بدراسة افكار الشاعر الامريكي (ثيودور روثكي) (1908-1963) فيما يخص تذبذب الهوية وفكرة الاتحاد الصوفية في شعره.يقع البحث في ثلاثة أقسام رئيسة؛ الاول منها هو مقدمة عن حياة الشاعر و فكره.يتبع ذلك ملاحظات عامة تلخص ابرز من أثر على فكر وشعر (روثكي) بهذا الخصوص.أما القسم الثاني فيضم متن البحث.اذ يكشف فيه الباحث عن نظرة الشاعر الى الكون والوجود ككل وعلاقة هذا الكل باجزاءه المكونة.ويسلط النقاش الضوء على جانبين هما:النفس البشرية و العالم المادي، والنفس البشرية و الالوهية.وتكشف القصائد المختارة للدراسة عن العلاقة الوثيقة التي تربط ما بين النفس و العالم المادي من جهة وبين الالوهية من جهة اخرى. كما تظهر القصائد تذبذب هوية المتكلم في القصائد وتقمصه هويات مختلفة خلال تواصله الروحي مع العالم الخارجي.وينتهي البحث بخاتمة تلخص أهم النتائج التي خلصت إليها الدراسة.

Listing 1 - 10 of 12 << page
of 2
>>
Sort by
Narrow your search

Resource type

article (12)


Language

English (9)

Arabic and English (2)

Arabic (1)


Year
From To Submit

2014 (12)